Diagnostic Molecul





Diagnostic Molecular Biology questions


I- Choose the correct answer  (put underline)?


1). DNA polymerase III can only add nucleotides to an existing chain, so _________________ is required.
a). An RNA primer
b). DNA polymerase I
c). Helicase
d). A DNA primer
Answer: a



2). Okazaki fragments are
A). Synthesized in the 3' to 5' direction.
B). Found on the lagging strand.
C). Found on the leading strand.
D). Assembled as continuous replication.
Answer: b



3). Each amino acid in a protein is specified by
A). Several genes.
B). A promoter.
C). An mRNA molecule.
D). A codon.
Answer: d
4). The three-nucleotide codon system can be arranged into ______________ combinations.
a). 16
b). 20
c). 64
d). 128
Answer: c
5). The site where RNA polymerase attaches to the DNA molecule to start the formation of RNA is called a(n)
a). promoter.
b). exon.
c). intron.
d). GC hairpin.
Answer: a



6). If an mRNA codon reads UAC, its complementary anticodon will be
a). TUC.
b). ATG.
c). AUG.
d). CAG.
Answer: c
7). The nucleotide sequences on DNA that actually have information encoding a sequence of amino acids are
a). Introns.
b). Exons.
c). UAA.
d). UGA.
Answer: b
8). Cutting certain genes out of molecules of DNA requires the use of special
A). Degrading nucleases.
B). Restriction endonucleases.
C). Eukaryotic enzymes.
D). Viral enzymes.
Answer: b
9). Which of the following cannot be used as a vector?
a). Phage
b). Plasmid
c). Bacterium
d). All can be used as vectors.
Answer: c
10). A probe is used in which stage of genetic engineering?
a). Cleaving DNA
b). Recombining DNA
c). Cloning
d). Screening
Answer: d
11). The substitution of one amino acid for another
A). Will change the primary structure of the polypeptide.
B). Can change the secondary structure of the polypeptide.
C). Can change the tertiary structure of the polypeptide.
D). All of these are correct.
Answer: d
12). Which of the following lists the purine nucleotides?
a). Adenine and cytosine
b). Guanine and thymine
c). Cytosine and thymine
d). Adenine and guanine
Answer: d



13). The two strands of a DNA molecule are held together through base-pairing. Which of the  following best describes the base-pairing in DNA?
A). Adenine forms two hydrogen bonds with thymine.
B). Adenine forms two hydrogen bonds with uracil.
C). Cytosine forms two hydrogen bonds with guanine.
D). Cytosine forms two hydrogen bonds with thymine.



14). Which one of the following is not a type of RNA?
a). nRNA (nuclear RNA)
b). mRNA (messenger RNA)
c). rRNA (ribosomal RNA)
d). tRNA (transfer RNA)
Answer: a
15). If one strand of a DNA molecule has the base sequence ATTGCAT, its complementary strand will have the sequence
a). ATTGCAT
b). TAACGTA
c). GCCATGC
d). CGGTACG


Answer: b


16). The enzyme used in the polymerase chain reaction is
A). Restriction endonuclease.
B). Reverse transcriptase.
C). DNA polymerase.
D). RNA polymerase.
Answer: c
17). A method used to distinguish DNA of one individual from another is
a). polymerase chain reaction.
b). cDNA.
c). reverse transcriptase.
d). restriction fragment length polymorphism.
Answer: d
18). Which of the following is not a method of posttranscriptional control in eukaryotic cells?
a). processing the transcript
b). selecting the mRNA molecules that are translated
c). digesting the DNA immediately after translation
d). selectively degrading the mRNA transcripts
Answer: c
19). DNA methylation of genes
A). Inhibits transcription by blocking the base-pairing between methylated cytosine and



guanine.
B). Inhibits transcription by blocking the base-pairing between uracil and adenine.
C). Prevents transcription by blocking the TATA sequence.
D). Makes sure that genes that are turned off remain turned off.
Answer: d



20). A type of DNA sequence that is located far from a gene but can promote its expression is a(n)
A). Promoter.
B). Activator.
C). Enhancer.
D). TATA box.
Answer: c


II- Put sign right (v )or wrong (X) and correct the wrong one?

1. (..x..) The genetic code consists of five-letter 'words' called codons formed from a sequence of five nucleotides (e.g. TAACT, CAGAA).

2. (..x..) The two types of base pairs form different numbers of hydrogen bonds, AT forming three hydrogen bonds, and GC forming two hydrogen bonds.

3. (..-..) Within a gene, the sequence of bases along a DNA strand defines a messenger RNA sequence, which then defines one or more protein sequences.

4. (..-..) DNA with high GC-content is more stable than DNA with low GC-content.

5. (..x..) RNA is made within living cells by DNA polymerases, enzymes that act to copy a DNA or RNA template into a new RNA strand through processes known as transcription or RNA replication, respectively.

6. (..x..) RNA is a double-stranded molecule and has a much shorter chain of nucleotides than DNA.

7. (..-..) Introns are spliced out of pre-mRNA by spliceosomes.

8. (..-..) The code is read by copying stretches of DNA into the related nucleic acid RNA, in a process called transcription.

9. (..x..) These hydroxyl groups in ribose make RNA more stable than DNA because it is more prone to hydrolysis.

10. (..x..) messenger RNA (mRNA) is a small RNA chain of about 80 nucleotides that transfers a specific amino acid to a growing polypeptide chain at the ribosomal site of protein synthesis during translation.

11. (..-..) In RNA, the complementary base to adenine is not thymine, as it is in DNA, but rather uracil.

12. (..-..) DNA usually occurs as linear chromosomes in eukaryotes, and circular chromosomes in prokaryotes.

13. (..x..) These chromosomes are duplicated before cells divide, in a process called DNA translation.

14. (..x..) Prokaryotic organisms store most of their DNA inside the cell nucleus and some of their DNA in organelles, such as mitochondria or chloroplasts.

15. (..-..) The backbone of the DNA strand is made from alternating phosphate and sugar residues.

III-Match the sentences from group 1 with the appropriate from group 2.

Group 1

Group 2


1. Western Blotting

2. Topoisomerases

3. Southern Blot

4. Restriction Endonucleases

5. Polymerases

6. Polymerase Chain Reaction.

7. Northern Blot

8. Ligases

9. Helicases

10. Expression Cloning

11. Endonucleases

12. Electrophoresis

13. Eastern Blotting

14. DNA Array

15. Allele Specific Oligonucleotide

Ø (8….) Are particularly important in lagging strand DNA replication, as they join together the short segments of DNA produced at the replication fork.

Ø (12….) Is one of the principal tools of molecular biology. The basic principle is that DNA, RNA, and proteins can all be separated by means of an electric field.

Ø (3….) Is a method for probing for the presence of a specific DNA sequence within a DNA sample.

Ø (7….) Is used to study the expression patterns of a specific type of RNA molecule as relative comparison among a set of different samples of RNA.

Ø (1….) In this method, proteins are first separated by size, in a thin gel sandwiched between two glass plates in a technique known as SDS-PAGE

Ø (13….) Technique is to detect post-translational modification of proteins.

Ø (14….) Is a collection of spots attached to a solid support such as a microscope slide where each spot contains one or more single-stranded DNA oligonucleotide fragment.

Ø (2….) Are enzymes with both nuclease and ligase activity. They change the amount of supercoiling in DNA.

Ø (9….) Are proteins that are a type of molecular motor. They break hydrogen bonds between bases and unwind the DNA double helix into single strands.

Ø (5….) Are enzymes that synthesize polynucleotide chains from nucleoside triphosphates.

Ø (11….) Enzymes that cut DNA strands within strands.

Ø (4….) The most frequently used nucleases in molecular biology, which cut DNA at specific sequences.

Ø (15….) Is a technique that allows detection of single base mutations without the need for PCR or gel electrophoresis.

Ø (10….) Is one of the most basic techniques of molecular biology to study protein function

Ø (6….) Is an extremely versatile technique for copying DNA, allows a single DNA sequence to be copied (millions of times).

Best Wishes

Dr. Alaa eldin

+++++++++++++++++++++++++++++++++++++++++

http://highered.mcgraw-hill.com/olcweb/styles/shared/spacer.gif

http://highered.mcgraw-hill.com/olcweb/styles/shared/spacer.gif

1- Write short note on two of the followings

2- Expression cloning

3- Polymerase chain reaction

4- Gel electrophoresis and blotting


7). Which of the following is not found in a eukaryotic transcription complex?
a). activator
b). RNA
c). enhancer
d). TATA-binding protein
Answer: b




11). The bases of RNA are the same as those of DNA with the exception that RNA contains
a). cysteine instead of cytosine.
b). uracil instead of thymine.
c). cytosine instead of guanine.
d). uracil instead of adenine.
Answer: b



15). X-ray diffraction experiments conducted by _____________ led to the determination of the structure of DNA.
a). Francis Crick
b). James Watson
c). Erwin Chargaff
d). Rosalind Franklin
Answer: d



14). DNA is made up of building blocks called
a). proteins.
b). bases.
c). nucleotides.
d). deoxyribose.
Answer: c



18). Protein motifs are considered a type of
A).  Primary structure.
B). Secondary structure.
C). Tertiary structure.
D). Quaternary structure.
Answer: b
7). When mRNA leaves the cell's nucleus, it next becomes associated with
a). proteins.
b). a ribosome.
c). tRNA.
d). RNA polymerase.
Answer: b
1). Prokaryotes and eukaryotes use several methods to regulate gene expression, but the most common method is
a). translational control.
b). transcriptional control.
c). posttranscriptional control.
d). control of mRNA passage from the nucleus.
Answer: b



3). Which of the following statements is incorrect.
a). DNA in the nucleus is usually coiled into chromosomes.
b). The nucleolus is the site of ribosomal RNA synthesis.
c). Some substances can pass into and out of the nucleus.
d). Red blood cells can not synthesize RNA.
Answer: a



9). Which of the following are not matched correctly?
a). RNA splicing-occurs in the nucleus
b). snRNP-splicing out exons from the transcript
c). poly-A tail-increased transcript stability
d). All are matched correctly.
Answer: b

10). Which of the following is not a method of posttranscriptional control in eukaryotic cells?
a). processing the transcript
b). selecting the mRNA molecules that are translated
c). digesting the DNA immediately after translation
d). selectively degrading the mRNA transcripts
Answer: c



1). Proteins, nucleic acids, lipids and carbohydrates all have certain characteristics in common. Which of the following is not a common characteristic?
a). They are organic, which means they are all living substances.
b). They all contain the element carbon.
c). They contain simpler units that are linked together making larger molecules.
d). They all contain functional groups.
Answer: a

2). A peptide bond forms by:
a). a condensation reaction.
b). dehydration synthesis.
c). the formation of a covalent bond.
d). all of these.
Answer: d





4). A(n) _______________ is a piece of DNA with a group of genes that are transcribed together as a unit.
a). promoter
b). repressor
c). operator
d). operon
Answer: d




5). The TATA box in eukaryotes is a
a). core promoter.
b). – 35 sequence.
c). – 10 sequence.
d). 5' cap.
Answer: a



2). Can you also explain why adenine does not base-pair with cytosine. and why thymine does not base-pair with guanine?
Answer: Hydrogen bonding, which holds the two DNA strands together, determines which nucleotides will form complementary base-pairs. Adenine is able to form two hydrogen bonds and so it lines up with thymine, which is also able to form two hydrogen bonds. Cytosine, which is a smaller nucleotide like thymine, does not base-pair with adenine because their hydrogen-bonding atoms would not line up correctly. Likewise, guanine is able to form three hydrogen bonds and so it lines up with cytosine. which is also able to form three hydrogen bonds. Guanine, which is larger like adenine, does not-base pair with thymine because their hydrogen-bonding atoms would not line up correctly.



2). From an extract of human cells growing in tissue culture, you obtain a white, fibrous substance. How would you distinguish whether it was DNA, RNA, or protein?
Answer: First you could test the substance for the presence of amino acids; if present, the substance is a protein. If the substance does not contain amino acids, it is one of the two nucleic acids. To determine which nucleic acid, you can either test the substance for the presence of ribose or deoxyribose or you can test the substance for the presence of thymine or uracil. The presence of thymine or deoxyribose indicates the substance is DNA. The presence of uracil or ribose indicates the substance is RNA.




2). The nucleotide sequence of a hypothetical eukaryotic gene is:
TACATACTAGTTACGTCGCCCGGAAATATC
If a mutation in this gene were to change the fifteenth nucleotide (underlined) from guanine to thymine, what effect do you think it might have on the expression of this gene?
Answer: The mRNA sequence of this gene is:
AUG UAU GAU CAA UGC AGC GGG CCU UUA UAG
The amino acid sequence for this sequence of codons is:
Met-Tyr-Asp-Glu-Cys-Ser-Gly-Pro-Leu-Stop
If the underlined guanine was changed to thymine the mRNA sequence for this codon would be UGU and the amino acid encoded by UGU is Cysteine, the same amino acid encoded by UGC, therefore there would be no effect of this mutation on the production of the protein.



1). Every cell in your body contains the same genomic DNA, yet the proteome of different tissues is unique. How can you explain this?
Answer: The proteome is comprised of the proteins present in any given cell at a specific time.

3). If you are given a sample of DNA from an unknown organism, how could you determine the origin of the DNA sample?
Answer: Comparing the sequence from the unknown organism with sequences deposited in public sequence databases will allow you to identify likely relatives based on the degree of sequence identity.



1.

List the 4 nitrogen bases for DNA and state which ones pair together.


2. State the composition of a: nucleoside, nucleotide, pyrimidine and purine.

3. State the 5 carbon sugar of DNA.

4. State the direction of DNA synthesis.

5. State the significance of numbering the carbons of the ribose sugar 1’ and 5’.

6. Define “Okazaki fragment”.

7. Describe the replication process of the “leading” and “lagging” strand in DNA synthesis.

8. Describe the overall process of DNA synthesis from beginning to end.

9. Given a sequence of nitrogen bases create the complementary strand.

Be able to define or describe the terms listed in the "Unit 3 Glossary of Terms










1. DNA ligases


2. Topoisomerases

3. Topoisomerases


4. Nucleases


5. exonucleases,


6. Enzymes can rejoin cut or broken DNA strands.

7. These enzymes are also needed to relieve the twisting stresses introduced into DNA strands during processes such as transcription and DNA replication.

8. are required for many processes involving DNA, such as DNA replication and transcription.

9. Are enzymes that cut DNA strands by catalyzing the hydrolysis of the phosphodiester bonds.

10. Nucleases that hydrolyse nucleotides from the ends of DNA strands


1. Molecular biology

2. Is the study of molecular underpinnings of the processes of replication, transcription, translation, and cell function.






ü A DNA sequence is called "sense" if its sequence is the same as that of a messenger RNA copy that is translated into protein. The sequence on the opposite strand is called the "antisense" sequence.

ü If the DNA is twisted in the direction of the helix, this is positive supercoiling, and the bases are held more tightly together. If they are twisted in the opposite direction, this is negative supercoiling, and the bases come apart more easily.

ü In nature, most DNA has slight negative supercoiling that is introduced by enzymes called topoisomerases. These enzymes are also needed to relieve the twisting stresses introduced into DNA strands during processes such as transcription and DNA replication.

ü The expression of genes is influenced by how the DNA is packaged in chromosomes, in a structure called chromatin.

ü Base modifications can be involved in packaging, with regions that have low or no gene expression usually containing high levels of methylation of cytosine bases.

ü Many mutagens fit into the space between two adjacent base pairs, this is called intercalation.

ü The set of chromosomes in a cell makes up its genome; the human genome has approximately 3 billion base pairs of DNA arranged into 46 chromosomes.

ü Genes contain an open reading frame that can be transcribed, as well as regulatory sequences such as promoters and enhancers, which control the transcription of the open reading frame.

ü Some noncoding DNA sequences play structural roles in chromosomes. Telomeres and centromeres typically contain few genes, but are important for the function and stability of chromosomes.

ü The double-stranded structure of DNA provides a simple mechanism for DNA replication. The complementary DNA sequence is recreated by an enzyme called DNA polymerase.

ü As DNA polymerases can only extend a DNA strand in a 5′ to 3′ direction, different mechanisms are used to copy the antiparallel strands of the double helix.

ü Enzymes can also bind to DNA and of these, the polymerases that copy the DNA base sequence in transcription and DNA replication are particularly important.

ü Nucleases are enzymes that cut DNA strands by catalyzing the hydrolysis of the phosphodiester bonds.

ü Nucleases that hydrolyse nucleotides from the ends of DNA strands are called exonucleases, while endonucleases cut within strands.

ü The most frequently used nucleases in molecular biology are the restriction endonucleases, which cut DNA at specific sequences.

ü Enzymes called DNA ligases can rejoin cut or broken DNA strands.

ü In eukaryotes DNA binding to a complex of small basic proteins called histones, while in prokaryotes multiple types of proteins are involved.

ü Ligases are particularly important in lagging strand DNA replication, as they join together the short segments of DNA produced at the replication fork into a complete copy of the DNA template.

ü Chemical modifications of these basic amino acid residues include methylation, phosphorylation and acetylation. These chemical changes alter the strength of the interaction between the DNA and the histones, making the DNA more or less accessible to transcription factors and changing the rate of transcription.

ü Topoisomerases are enzymes with both nuclease and ligase activity. These proteins change the amount of supercoiling in DNA. Some of these enzymes work by cutting the DNA helix and allowing one section to rotate, thereby reducing its level of supercoiling; the enzyme then seals the DNA break. Other types of these enzymes are capable of cutting one DNA helix and then passing a second strand of DNA through this break, before rejoining the helix.

ü Topoisomerases are required for many processes involving DNA, such as DNA replication and transcription.

ü Helicases are proteins that are a type of molecular motor. They use the chemical energy in nucleoside triphosphates, predominantly ATP, to break hydrogen bonds between bases and unwind the DNA double helix into single strands.

ü Polymerases are enzymes that synthesize polynucleotide chains from nucleoside triphosphates. The sequence of their products are copies of existing polynucleotide chains - which are called templates.

ü These enzymes function by adding nucleotides onto the 3′ hydroxyl group of the previous nucleotide in a DNA strand. As a consequence, all polymerases work in a 5′ to 3′ direction.

ü In DNA replication, a DNA-dependent DNA polymerase makes a copy of a DNA sequence. Accuracy is vital in this process, so many of these polymerases have a proofreading activity. Here, the polymerase recognizes the occasional mistakes in the synthesis reaction by the lack of base pairing between the mismatched nucleotides. If a mismatch is detected, a 3′ to 5′ exonuclease activity is activated and the incorrect base removed.

ü RNA-dependent DNA polymerases are a specialized class of polymerases that copy the sequence of an RNA strand into DNA. They include reverse transcriptase, which is a viral enzyme involved in the infection of cells by retroviruses, and telomerase, which is required for the replication of telomeres. Telomerase is an unusual polymerase because it contains its own RNA template as part of its structure.

ü Transcription is carried out by a DNA-dependent RNA polymerase that copies the sequence of a DNA strand into RNA.

ü To begin transcribing a gene, the RNA polymerase binds to a sequence of DNA called a promoter and separates the DNA strands. It then copies the gene sequence into a messenger RNA transcript until it reaches a region of DNA called the terminator, where it halts and detaches from the DNA.

ü As with human DNA-dependent DNA polymerases, RNA polymerase II, the enzyme that transcribes most of the genes in the human genome, operates as part of a large protein complex with multiple regulatory and accessory subunits.

ü The chemical structure of RNA is very similar to that of DNA, with two differences - (a) RNA contains the sugar ribose while DNA contains the slightly different sugar deoxyribose (a type of ribose that lacks one oxygen atom), and (b) RNA has the nucleobase uracil while DNA contains thymine (uracil and thymine have similar base-pairing properties).

ü Each nucleotide in RNA contains a ribose sugar, with carbons numbered 1' through 5'. A base is attached to the 1' position, in general, adenine (A), cytosine (C), guanine (G), or uracil (U).

ü Adenine and guanine are purines, cytosine, and uracil are pyrimidines.

ü A phosphate group is attached to the 3' position of one ribose and the 5' position of the next. The phosphate groups have a negative charge each at physiological pH, making RNA a charged molecule (polyanion). The bases may form hydrogen bonds between cytosine and guanine, between adenine and uracil and between guanine and uracil.

ü DNA can be damaged by many sorts of mutagens, which change the DNA sequence. Mutagens include oxidizing agents, alkylating agents and also high-energy electromagnetic radiation such as ultraviolet light and X-rays. The type of DNA damage produced depends on the type of mutagen.

ü The information carried by DNA is held in the sequence of pieces of DNA called genes.

ü Transmission of genetic information in genes is achieved via complementary base pairing.

ü For example, in transcription, when a cell uses the information in a gene, the DNA sequence is copied into a complementary RNA sequence through the attraction between the DNA and the correct RNA nucleotides.

ü Usually, this RNA copy is then used to make a matching protein sequence in a process called translation, which depends on the same interaction between RNA nucleotides.

ü In alternative fashion, a cell may simply copy its genetic information in a process called DNA replication.

ü Genomic DNA is tightly and orderly packed in the process called DNA condensation to fit the small available volumes of the cell.

ü In eukaryotes, DNA is located in the cell nucleus, as well as small amounts in mitochondria and chloroplasts.

ü In prokaryotes, the DNA is held within an irregularly shaped body in the cytoplasm called the nucleoid.

ü The genetic information in a genome is held within genes, and the complete set of this information in an organism is called its genotype.

ü A gene is a unit of heredity and is a region of DNA that influences a particular characteristic in an organism.

ü A gene is a sequence of DNA that contains genetic information and can influence the phenotype of an organism.

ü DNA replication. The double helix is unwound by a helicase and topoisomerase. Next, one DNA polymerase produces the leading strand copy. Another DNA polymerase binds to the lagging strand. This enzyme makes discontinuous segments (called Okazaki fragments) before DNA ligase joins them together.

ü In transcription, the codons of a gene are copied into messenger RNA by RNA polymerase. This RNA copy is then decoded by a ribosome that reads the RNA sequence by base-pairing the messenger RNA to transfer RNA, which carries amino acids.

ü Since there are 4 bases in 3-letter combinations, there are 64 possible codons (43 combinations). These encode the twenty standard amino acids, giving most amino acids more than one possible codon. There are also three 'stop' or 'nonsense' codons signifying the end of the coding region; these are the TAA, TGA and TAG codons.

ü An important structural feature of RNA that distinguishes it from DNA is the presence of a hydroxyl group at the 2' position of the ribose sugar. The presence of this functional group causes the helix to adopt the A-form geometry rather than the B-form most commonly observed in DNA.

ü RNA is transcribed with only four bases (adenine, cytosine, guanine and uracil), but these bases and attached sugars can be modified in numerous ways as the RNAs mature.

ü The functional form of single stranded RNA molecules, just like proteins, frequently requires a specific tertiary structure. The scaffold for this structure is provided by secondary structural elements that are hydrogen bonds within the molecule. This leads to several recognizable "domains" of secondary structure like hairpin loops, bulges, and internal loops. Since RNA is charged, metal ions such as Mg2+ are needed to stabilize many secondary and tertiary structures.

ü The DNA sequence also dictates where termination of RNA synthesis will occur. RNAs are often modified by enzymes after transcription. For example, a poly(A) tail and a 5' cap are added to eukaryotic pre-mRNA and introns are removed by the spliceosome.

ü There are also a number of RNA-dependent RNA polymerases that use RNA as their template for synthesis of a new strand of RNA. For instance, a number of RNA viruses (such as poliovirus) use this type of enzyme to replicate their genetic material.

ü Messenger RNA (mRNA) is the RNA that carries information from DNA to the ribosome, the sites of protein synthesis (translation) in the cell. The coding sequence of the mRNA determines the amino acid sequence in the protein that is produced.

ü Many RNAs do not code for protein however (about 97% of the transcriptional output is non-protein-coding in eukaryotes).

ü These so-called non-coding RNAs ("ncRNA") can be encoded by their own genes (RNA genes), but can also derive from mRNA introns.

ü The most prominent examples of non-coding RNAs are transfer RNA (tRNA) and ribosomal RNA (rRNA), both of which are involved in the process of translation. There are also non-coding RNAs involved in gene regulation, RNA processing and other roles.

ü Certain RNAs are able to catalyse chemical reactions such as cutting and ligating other RNA molecules, and the catalysis of peptide bond formation in the ribosome; these are known as ribozymes.

ü Messenger RNA (mRNA) carries information about a protein sequence to the ribosomes, the protein synthesis factories in the cell. It is coded so that every three nucleotides (a codon) correspond to one amino acid. In eukaryotic cells, once precursor mRNA (pre-mRNA) has been transcribed from DNA, it is processed to mature mRNA.

ü After a certain amount of time the message degrades into its component nucleotides with the assistance of ribonucleases.

ü The viral genome is replicated by some of those proteins, while other proteins protect the genome as the virus particle moves to a new host cell. Viroids are another group of pathogens, but they consist only of RNA, do not encode any protein and are replicated by a host plant cell's polymerase.

ü In reverse transcription Reverse transcribing viruses replicate their genomes by reverse transcribing DNA copies from their RNA; these DNA copies are then transcribed to new RNA. Retrotransposons also spread by copying DNA and RNA from one another, and telomerase contains an RNA that is used as template for building the ends of eukaryotic chromosomes.

ü Double-stranded RNA (dsRNA) is RNA with two complementary strands, similar to the DNA found in all cells. dsRNA forms the genetic material of some viruses (double-stranded RNA viruses). Double-stranded RNA such as viral RNA or siRNA can trigger RNA interference in eukaryotes, as well as interferon response in vertebrates.

ü Each type of base on one strand forms a bond with just one type of base on the other strand. GC base pair with three hydrogen bonds while AT base pair with two hydrogen bonds.

ü

ü (....) Introns are spliced out of pre-mRNA by spliceosomes, which contain several small nuclear RNAs (snRNA), or the introns can be ribozymes that are spliced by themselves

ü (.. ..) The relationship between the nucleotide sequences of genes and the amino-acid sequences of proteins is determined by the rules of translation, known collectively as the genetic code.

ü (.. ..) Ribosomal RNA (rRNA) is the catalytic component of the ribosomes. Eukaryotic ribosomes contain four different rRNA molecules: 18S, 5.8S, 28S and 5S rRNA.

ü (.. ..) Transfer-messenger RNA (tmRNA) is found in many bacteria and plastids. It tags proteins encoded by mRNAs that lack stop codons for degradation and prevents the ribosome from stalling.

ü Synthesis of RNA is usually catalyzed by an enzyme—RNA polymerase—using DNA as a template, a process known as transcription

ü (.. ..) Like DNA, RNA can carry genetic information. RNA viruses have genomes composed of RNA, and a variety of proteins encoded by that genome.

ü (.. ..) DNA consists of two long polymers of simple units called nucleotides, with backbones made of sugars and phosphate groups joined by ester bonds.

ü

ü Initiation of transcription begins with the binding of the enzyme to a promoter sequence in the DNA (usually found "upstream" of a gene). The DNA double helix is unwound by the helicase activity of the enzyme. The enzyme then progresses along the template strand in the 3’ to 5’ direction, synthesizing a complementary RNA molecule with elongation occurring in the 5’ to 3’ direction.

ü In contrast, prokaryotes store their DNA only in the cytoplasm. Within the chromosomes, chromatin proteins such as histones compact and organize DNA.

ü A base linked to a sugar is called a nucleoside and a base linked to a sugar and one or more phosphate groups is called a nucleotide.

ü These asymmetric bonds mean a strand of DNA has a direction. In a double helix the direction of the nucleotides in one strand is opposite to their direction in the other strand: the strands are antiparallel.

ü One major difference between DNA and RNA is the sugar, with the 2-deoxyribose in DNA being replaced by the alternative pentose sugar ribose in RNA.

Assay: Proteins are assembled from amino acids using information encoded in genes.

Diagnostic Molecular Biology

5- Write short note on two of the followings

6- Expression cloning

7- Polymerase chain reaction

8- Gel electrophoresis and blotting


1). The bases of RNA are the same as those of DNA with the exception that RNA contains
a). cysteine instead of cytosine.
b). uracil instead of thymine.
c). cytosine instead of guanine.
d). uracil instead of adenine.
Answer: b
2). Which one of the following is not a type of RNA?
a). nRNA (nuclear RNA)
b). mRNA (messenger RNA)
c). rRNA (ribosomal RNA)
d). tRNA (transfer RNA)
Answer: a
3). If one strand of a DNA molecule has the base sequence ATTGCAT, its complementary strand will have the sequence
a). ATTGCAT
b). TAACGTA
c). GCCATGC
d). CGGTACG
Answer: b



4). DNA is made up of building blocks called
a). proteins.
b). bases.
c). nucleotides.
d). deoxyribose.
Answer: c



5). X-ray diffraction experiments conducted by _____________ led to the determination of the structure of DNA.
a). Francis Crick
b). James Watson
c). Erwin Chargaff
d). Rosalind Franklin
Answer: d



7). DNA polymerase III can only add nucleotides to an existing chain, so _________________ is required.
a). an RNA primer
b). DNA polymerase I
c). helicase
d). a DNA primer
Answer: a



8). Okazaki fragments are
a). synthesized in the 3' to 5' direction.
b). found on the lagging strand.
c). found on the leading strand.
d). assembled as continuous replication.
Answer: b



3). Each amino acid in a protein is specified by
a). several genes.
b). a promoter.
c). an mRNA molecule.
d). a codon.
Answer: d

4). The three-nucleotide codon system can be arranged into ______________ combinations.
a). 16
b). 20
c). 64
d). 128
Answer: c
5). The TATA box in eukaryotes is a
a). core promoter.
b). – 35 sequence.
c). – 10 sequence.
d). 5' cap.
Answer: a

6). The site where RNA polymerase attaches to the DNA molecule to start the formation of RNA is called a(n)
a). promoter.
b). exon.
c). intron.
d). GC hairpin.
Answer: a

7). When mRNA leaves the cell's nucleus, it next becomes associated with
a). proteins.
b). a ribosome.
c). tRNA.
d). RNA polymerase.
Answer: b

8). If an mRNA codon reads UAC, its complementary anticodon will be
a). TUC.
b). ATG.
c). AUG.
d). CAG.
Answer: c

9). The nucleotide sequences on DNA that actually have information encoding a sequence of amino acids are
a). introns.
b). exons.
c). UAA.
d). UGA.
Answer: b



1). Cutting certain genes out of molecules of DNA requires the use of special
a). degrading nucleases.
b). restriction endonucleases.
c). eukaryotic enzymes.
d). viral enzymes.
Answer: b

2). Which of the following cannot be used as a vector?
a). phage
b). plasmid
c). bacterium
d). All can be used as vectors.
Answer: c



5). A probe is used in which stage of genetic engineering?
a). cleaving DNA
b). recombining DNA
c). cloning
d). screening
Answer: d

6). The enzyme used in the polymerase chain reaction is
a). restriction endonuclease.
b). reverse transcriptase.
c). DNA polymerase.
d). RNA polymerase.
Answer: c

7). A method used to distinguish DNA of one individual from another is
a). polymerase chain reaction.
b). cDNA.
c). reverse transcriptase.
d). restriction fragment length polymorphism.
Answer: d

1). Prokaryotes and eukaryotes use several methods to regulate gene expression, but the most common method is
a). translational control.
b). transcriptional control.
c). posttranscriptional control.
d). control of mRNA passage from the nucleus.
Answer: b



8). DNA methylation of genes
a). inhibits transcription by blocking the base-pairing between methylated cytosine and guanine.
b). inhibits transcription by blocking the base-pairing between uracil and adenine.
c). prevents transcription by blocking the TATA sequence.
d). makes sure that genes that are turned off remain turned off.
Answer: d

9). Which of the following are not matched correctly?
a). RNA splicing-occurs in the nucleus
b). snRNP-splicing out exons from the transcript
c). poly-A tail-increased transcript stability
d). All are matched correctly.
Answer: b

10). Which of the following is not a method of posttranscriptional control in eukaryotic cells?
a). processing the transcript
b). selecting the mRNA molecules that are translated
c). digesting the DNA immediately after translation
d). selectively degrading the mRNA transcripts
Answer: c



1). Proteins, nucleic acids, lipids and carbohydrates all have certain characteristics in common. Which of the following is not a common characteristic?
a). They are organic, which means they are all living substances.
b). They all contain the element carbon.
c). They contain simpler units that are linked together making larger molecules.
d). They all contain functional groups.
Answer: a

2). A peptide bond forms by:
a). a condensation reaction.
b). dehydration synthesis.
c). the formation of a covalent bond.
d). all of these.
Answer: d

3). Protein motifs are considered a type of
a). primary structure.
b). secondary structure.
c). tertiary structure.
d). quaternary structure.
Answer: b

4). The substitution of one amino acid for another
a). will change the primary structure of the polypeptide.
b). can change the secondary structure of the polypeptide.
c). can change the tertiary structure of the polypeptide.
d). All of these are correct.
Answer: d


6). Which of the following lists the purine nucleotides?
a). adenine and cytosine
b). guanine and thymine
c). cytosine and thymine
d). adenine and guanine
Answer: d

7). The two strands of a DNA molecule are held together through base-pairing. Which of the following best describes the base-pairing in DNA?
a). Adenine forms two hydrogen bonds with thymine.
b). Adenine forms two hydrogen bonds with uracil.
c). Cytosine forms two hydrogen bonds with guanine.
d). Cytosine forms two hydrogen bonds with thymine.
Answer: a



3). Which of the following statements is incorrect.
a). DNA in the nucleus is usually coiled into chromosomes.
b). The nucleolus is the site of ribosomal RNA synthesis.
c). Some substances can pass into and out of the nucleus.
d). Red blood cells can not synthesize RNA.
Answer: a




4). A(n) _______________ is a piece of DNA with a group of genes that are transcribed together as a unit.
a). promoter
b). repressor
c). operator
d). operon
Answer: d

6). A type of DNA sequence that is located far from a gene but can promote its expression is a(n)
a). promoter.
b). activator.
c). enhancer.
d). TATA box.
Answer: c

7). Which of the following is not found in a eukaryotic transcription complex?
a). activator
b). RNA
c). enhancer
d). TATA-binding protein
Answer: b




2). Can you also explain why adenine does not base-pair with cytosine. and why thymine does not base-pair with guanine?
Answer: Hydrogen bonding, which holds the two DNA strands together, determines which nucleotides will form complementary base-pairs. Adenine is able to form two hydrogen bonds and so it lines up with thymine, which is also able to form two hydrogen bonds. Cytosine, which is a smaller nucleotide like thymine, does not base-pair with adenine because their hydrogen-bonding atoms would not line up correctly. Likewise, guanine is able to form three hydrogen bonds and so it lines up with cytosine. which is also able to form three hydrogen bonds. Guanine, which is larger like adenine, does not-base pair with thymine because their hydrogen-bonding atoms would not line up correctly.



2). From an extract of human cells growing in tissue culture, you obtain a white, fibrous substance. How would you distinguish whether it was DNA, RNA, or protein?
Answer: First you could test the substance for the presence of amino acids; if present, the substance is a protein. If the substance does not contain amino acids, it is one of the two nucleic acids. To determine which nucleic acid, you can either test the substance for the presence of ribose or deoxyribose or you can test the substance for the presence of thymine or uracil. The presence of thymine or deoxyribose indicates the substance is DNA. The presence of uracil or ribose indicates the substance is RNA.




2). The nucleotide sequence of a hypothetical eukaryotic gene is:
TACATACTAGTTACGTCGCCCGGAAATATC
If a mutation in this gene were to change the fifteenth nucleotide (underlined) from guanine to thymine, what effect do you think it might have on the expression of this gene?
Answer: The mRNA sequence of this gene is:
AUG UAU GAU CAA UGC AGC GGG CCU UUA UAG
The amino acid sequence for this sequence of codons is:
Met-Tyr-Asp-Glu-Cys-Ser-Gly-Pro-Leu-Stop
If the underlined guanine was changed to thymine the mRNA sequence for this codon would be UGU and the amino acid encoded by UGU is Cysteine, the same amino acid encoded by UGC, therefore there would be no effect of this mutation on the production of the protein.



1). Every cell in your body contains the same genomic DNA, yet the proteome of different tissues is unique. How can you explain this?
Answer: The proteome is comprised of the proteins present in any given cell at a specific time.

3). If you are given a sample of DNA from an unknown organism, how could you determine the origin of the DNA sample?
Answer: Comparing the sequence from the unknown organism with sequences deposited in public sequence databases will allow you to identify likely relatives based on the degree of sequence identity.



10.

List the 4 nitrogen bases for DNA and state which ones pair together.


11. State the composition of a: nucleoside, nucleotide, pyrimidine and purine.

12. State the 5 carbon sugar of DNA.

13. State the direction of DNA synthesis.

14. State the significance of numbering the carbons of the ribose sugar 1’ and 5’.

15. Define “Okazaki fragment”.

16. Describe the replication process of the “leading” and “lagging” strand in DNA synthesis.

17. Describe the overall process of DNA synthesis from beginning to end.

18. Given a sequence of nitrogen bases create the complementary strand.

Be able to define or describe the terms listed in the "Unit 3 Glossary of Terms

+++++++++++++++++++++++++++++++++++++++++

http://highered.mcgraw-hill.com/olcweb/styles/shared/spacer.gif

http://highered.mcgraw-hill.com/olcweb/styles/shared/spacer.gif










11. DNA ligases

12. Ligases

13. Topoisomerases

14. Topoisomerases

15. Topoisomerases

16. Helicases


17. Polymerases

18. Nucleases


19. exonucleases,

20. endonucleases

21. restriction endonucleases


22. Enzymes can rejoin cut or broken DNA strands.

23. Are particularly important in lagging strand DNA replication, as they join together the short segments of DNA produced at the replication fork into a complete copy of the DNA template.

24. Are enzymes with both nuclease and ligase activity. They change the amount of supercoiling in DNA.

25. These enzymes are also needed to relieve the twisting stresses introduced into DNA strands during processes such as transcription and DNA replication.

26. are required for many processes involving DNA, such as DNA replication and transcription.

27. Are proteins that are a type of molecular motor. They use the chemical energy in nucleoside triphosphates, predominantly ATP, to break hydrogen bonds between bases and unwind the DNA double helix into single strands. These enzymes are essential for most processes where enzymes need to access the DNA bases.

28. Are enzymes that synthesize polynucleotide chains from nucleoside triphosphates. The sequence of their products are copies of existing polynucleotide chains - which are called templates.

29. Are enzymes that cut DNA strands by catalyzing the hydrolysis of the phosphodiester bonds.

30. Nucleases that hydrolyse nucleotides from the ends of DNA strands

31. Nucleases that cut DNA strands within strands.

32. The most frequently used nucleases in molecular biology, which cut DNA at specific sequences.


3. Expression cloning

4. Polymerase chain reaction.

5. Electrophoresis

6. Southern blot

7. Northern blot

8. Western blotting

9. Eastern blotting


10. DNA array

11. Allele specific oligonucleotide

12. Molecular biology

13. Is one of the most basic techniques of molecular biology to study protein function

14. Is an extremely versatile technique for copying DNA, allows a single DNA sequence to be copied (millions of times).

15. Is one of the principal tools of molecular biology. The basic principle is that DNA, RNA, and proteins can all be separated by means of an electric field.

16. Is a method for probing for the presence of a specific DNA sequence within a DNA sample.

17. Is used to study the expression patterns of a specific type of RNA molecule as relative comparison among a set of different samples of RNA.

18. Proteins are first separated by size, in a thin gel sandwiched between two glass plates in a technique known as SDS-PAGE

19. Technique is to detect post-translational modification of proteins.



20. Is a collection of spots attached to a solid support such as a microscope slide where each spot contains one or more single-stranded dna oligonucleotide fragment.

21. Is the study of molecular underpinnings of the processes of replication, transcription, translation, and cell function.

22. Is a technique that allows detection of single base mutations without the need for PCR or gel electrophoresis.




ü DNA consists of two long polymers of simple units called nucleotides, with backbones made of sugars and phosphate groups joined by ester bonds.

ü The code is read by copying stretches of DNA into the related nucleic acid RNA, in a process called transcription.

ü Within cells, DNA is organized into long structures called chromosomes. These chromosomes are duplicated before cells divide, in a process called DNA replication.

ü Eukaryotic organisms store most of their DNA inside the cell nucleus and some of their DNA in organelles, such as mitochondria or chloroplasts.

ü In contrast, prokaryotes store their DNA only in the cytoplasm. Within the chromosomes, chromatin proteins such as histones compact and organize DNA.

ü A base linked to a sugar is called a nucleoside and a base linked to a sugar and one or more phosphate groups is called a nucleotide.

ü The backbone of the DNA strand is made from alternating phosphate and sugar residues.

ü These asymmetric bonds mean a strand of DNA has a direction. In a double helix the direction of the nucleotides in one strand is opposite to their direction in the other strand: the strands are antiparallel.

ü One major difference between DNA and RNA is the sugar, with the 2-deoxyribose in DNA being replaced by the alternative pentose sugar ribose in RNA.

ü Each type of base on one strand forms a bond with just one type of base on the other strand. GC base pair with three hydrogen bonds while AT base pair with two hydrogen bonds.

ü The two types of base pairs form different numbers of hydrogen bonds, AT forming two hydrogen bonds, and GC forming three hydrogen bonds.

ü DNA with high GC-content is more stable than DNA with low GC-content.

ü DNA usually occurs as linear chromosomes in eukaryotes, and circular chromosomes in prokaryotes.

ü A DNA sequence is called "sense" if its sequence is the same as that of a messenger RNA copy that is translated into protein. The sequence on the opposite strand is called the "antisense" sequence.

ü If the DNA is twisted in the direction of the helix, this is positive supercoiling, and the bases are held more tightly together. If they are twisted in the opposite direction, this is negative supercoiling, and the bases come apart more easily.

ü In nature, most DNA has slight negative supercoiling that is introduced by enzymes called topoisomerases. These enzymes are also needed to relieve the twisting stresses introduced into DNA strands during processes such as transcription and DNA replication.

ü The expression of genes is influenced by how the DNA is packaged in chromosomes, in a structure called chromatin.

ü Base modifications can be involved in packaging, with regions that have low or no gene expression usually containing high levels of methylation of cytosine bases.

ü Many mutagens fit into the space between two adjacent base pairs, this is called intercalation.

ü The set of chromosomes in a cell makes up its genome; the human genome has approximately 3 billion base pairs of DNA arranged into 46 chromosomes.

ü Genes contain an open reading frame that can be transcribed, as well as regulatory sequences such as promoters and enhancers, which control the transcription of the open reading frame.

ü Some noncoding DNA sequences play structural roles in chromosomes. Telomeres and centromeres typically contain few genes, but are important for the function and stability of chromosomes.

ü The double-stranded structure of DNA provides a simple mechanism for DNA replication. The complementary DNA sequence is recreated by an enzyme called DNA polymerase.

ü As DNA polymerases can only extend a DNA strand in a 5′ to 3′ direction, different mechanisms are used to copy the antiparallel strands of the double helix.

ü Enzymes can also bind to DNA and of these, the polymerases that copy the DNA base sequence in transcription and DNA replication are particularly important.

ü Nucleases are enzymes that cut DNA strands by catalyzing the hydrolysis of the phosphodiester bonds.

ü Nucleases that hydrolyse nucleotides from the ends of DNA strands are called exonucleases, while endonucleases cut within strands.

ü The most frequently used nucleases in molecular biology are the restriction endonucleases, which cut DNA at specific sequences.

ü Enzymes called DNA ligases can rejoin cut or broken DNA strands.

ü In eukaryotes DNA binding to a complex of small basic proteins called histones, while in prokaryotes multiple types of proteins are involved.

ü Ligases are particularly important in lagging strand DNA replication, as they join together the short segments of DNA produced at the replication fork into a complete copy of the DNA template.

ü Chemical modifications of these basic amino acid residues include methylation, phosphorylation and acetylation. These chemical changes alter the strength of the interaction between the DNA and the histones, making the DNA more or less accessible to transcription factors and changing the rate of transcription.

ü Topoisomerases are enzymes with both nuclease and ligase activity. These proteins change the amount of supercoiling in DNA. Some of these enzymes work by cutting the DNA helix and allowing one section to rotate, thereby reducing its level of supercoiling; the enzyme then seals the DNA break. Other types of these enzymes are capable of cutting one DNA helix and then passing a second strand of DNA through this break, before rejoining the helix.

ü Topoisomerases are required for many processes involving DNA, such as DNA replication and transcription.

ü Helicases are proteins that are a type of molecular motor. They use the chemical energy in nucleoside triphosphates, predominantly ATP, to break hydrogen bonds between bases and unwind the DNA double helix into single strands.

ü Polymerases are enzymes that synthesize polynucleotide chains from nucleoside triphosphates. The sequence of their products are copies of existing polynucleotide chains - which are called templates.

ü These enzymes function by adding nucleotides onto the 3′ hydroxyl group of the previous nucleotide in a DNA strand. As a consequence, all polymerases work in a 5′ to 3′ direction.

ü In DNA replication, a DNA-dependent DNA polymerase makes a copy of a DNA sequence. Accuracy is vital in this process, so many of these polymerases have a proofreading activity. Here, the polymerase recognizes the occasional mistakes in the synthesis reaction by the lack of base pairing between the mismatched nucleotides. If a mismatch is detected, a 3′ to 5′ exonuclease activity is activated and the incorrect base removed.

ü RNA-dependent DNA polymerases are a specialized class of polymerases that copy the sequence of an RNA strand into DNA. They include reverse transcriptase, which is a viral enzyme involved in the infection of cells by retroviruses, and telomerase, which is required for the replication of telomeres. Telomerase is an unusual polymerase because it contains its own RNA template as part of its structure.

ü Transcription is carried out by a DNA-dependent RNA polymerase that copies the sequence of a DNA strand into RNA.

ü To begin transcribing a gene, the RNA polymerase binds to a sequence of DNA called a promoter and separates the DNA strands. It then copies the gene sequence into a messenger RNA transcript until it reaches a region of DNA called the terminator, where it halts and detaches from the DNA.

ü As with human DNA-dependent DNA polymerases, RNA polymerase II, the enzyme that transcribes most of the genes in the human genome, operates as part of a large protein complex with multiple regulatory and accessory subunits.

ü The chemical structure of RNA is very similar to that of DNA, with two differences - (a) RNA contains the sugar ribose while DNA contains the slightly different sugar deoxyribose (a type of ribose that lacks one oxygen atom), and (b) RNA has the nucleobase uracil while DNA contains thymine (uracil and thymine have similar base-pairing properties).

ü RNA is made within living cells by RNA polymerases, enzymes that act to copy a DNA or RNA template into a new RNA strand through processes known as transcription or RNA replication, respectively.

ü RNA is a single-stranded molecule and has a much shorter chain of nucleotides than DNA.

ü RNA contains ribose (in deoxyribose there is no hydroxyl group attached to the pentose ring in the 2' position). These hydroxyl groups make RNA less stable than DNA because it is more prone to hydrolysis.

ü the complementary base to adenine is not thymine, as it is in DNA, but rather uracil, which is an unmethylated form of thymine.

ü Each nucleotide in RNA contains a ribose sugar, with carbons numbered 1' through 5'. A base is attached to the 1' position, in general, adenine (A), cytosine (C), guanine (G), or uracil (U).

ü Adenine and guanine are purines, cytosine, and uracil are pyrimidines.

ü A phosphate group is attached to the 3' position of one ribose and the 5' position of the next. The phosphate groups have a negative charge each at physiological pH, making RNA a charged molecule (polyanion). The bases may form hydrogen bonds between cytosine and guanine, between adenine and uracil and between guanine and uracil.

ü DNA can be damaged by many sorts of mutagens, which change the DNA sequence. Mutagens include oxidizing agents, alkylating agents and also high-energy electromagnetic radiation such as ultraviolet light and X-rays. The type of DNA damage produced depends on the type of mutagen.

ü The information carried by DNA is held in the sequence of pieces of DNA called genes.

ü Transmission of genetic information in genes is achieved via complementary base pairing.

ü For example, in transcription, when a cell uses the information in a gene, the DNA sequence is copied into a complementary RNA sequence through the attraction between the DNA and the correct RNA nucleotides.

ü Usually, this RNA copy is then used to make a matching protein sequence in a process called translation, which depends on the same interaction between RNA nucleotides.

ü In alternative fashion, a cell may simply copy its genetic information in a process called DNA replication.

ü Genomic DNA is tightly and orderly packed in the process called DNA condensation to fit the small available volumes of the cell.

ü In eukaryotes, DNA is located in the cell nucleus, as well as small amounts in mitochondria and chloroplasts.

ü In prokaryotes, the DNA is held within an irregularly shaped body in the cytoplasm called the nucleoid.

ü The genetic information in a genome is held within genes, and the complete set of this information in an organism is called its genotype.

ü A gene is a unit of heredity and is a region of DNA that influences a particular characteristic in an organism.

ü A gene is a sequence of DNA that contains genetic information and can influence the phenotype of an organism.

ü Within a gene, the sequence of bases along a DNA strand defines a messenger RNA sequence, which then defines one or more protein sequences.

ü The relationship between the nucleotide sequences of genes and the amino-acid sequences of proteins is determined by the rules of translation, known collectively as the genetic code. The genetic code consists of three-letter 'words' called codons formed from a sequence of three nucleotides (e.g. ACT, CAG, TTT).

ü DNA replication. The double helix is unwound by a helicase and topoisomerase. Next, one DNA polymerase produces the leading strand copy. Another DNA polymerase binds to the lagging strand. This enzyme makes discontinuous segments (called Okazaki fragments) before DNA ligase joins them together.

ü In transcription, the codons of a gene are copied into messenger RNA by RNA polymerase. This RNA copy is then decoded by a ribosome that reads the RNA sequence by base-pairing the messenger RNA to transfer RNA, which carries amino acids.

ü Since there are 4 bases in 3-letter combinations, there are 64 possible codons (43 combinations). These encode the twenty standard amino acids, giving most amino acids more than one possible codon. There are also three 'stop' or 'nonsense' codons signifying the end of the coding region; these are the TAA, TGA and TAG codons.

ü An important structural feature of RNA that distinguishes it from DNA is the presence of a hydroxyl group at the 2' position of the ribose sugar. The presence of this functional group causes the helix to adopt the A-form geometry rather than the B-form most commonly observed in DNA.

ü RNA is transcribed with only four bases (adenine, cytosine, guanine and uracil), but these bases and attached sugars can be modified in numerous ways as the RNAs mature.

ü The functional form of single stranded RNA molecules, just like proteins, frequently requires a specific tertiary structure. The scaffold for this structure is provided by secondary structural elements that are hydrogen bonds within the molecule. This leads to several recognizable "domains" of secondary structure like hairpin loops, bulges, and internal loops. Since RNA is charged, metal ions such as Mg2+ are needed to stabilize many secondary and tertiary structures.

ü Synthesis of RNA is usually catalyzed by an enzyme—RNA polymerase—using DNA as a template, a process known as transcription.

ü Initiation of transcription begins with the binding of the enzyme to a promoter sequence in the DNA (usually found "upstream" of a gene). The DNA double helix is unwound by the helicase activity of the enzyme. The enzyme then progresses along the template strand in the 3’ to 5’ direction, synthesizing a complementary RNA molecule with elongation occurring in the 5’ to 3’ direction.

ü The DNA sequence also dictates where termination of RNA synthesis will occur. RNAs are often modified by enzymes after transcription. For example, a poly(A) tail and a 5' cap are added to eukaryotic pre-mRNA and introns are removed by the spliceosome.

ü There are also a number of RNA-dependent RNA polymerases that use RNA as their template for synthesis of a new strand of RNA. For instance, a number of RNA viruses (such as poliovirus) use this type of enzyme to replicate their genetic material.

ü Messenger RNA (mRNA) is the RNA that carries information from DNA to the ribosome, the sites of protein synthesis (translation) in the cell. The coding sequence of the mRNA determines the amino acid sequence in the protein that is produced.

ü Many RNAs do not code for protein however (about 97% of the transcriptional output is non-protein-coding in eukaryotes).

ü These so-called non-coding RNAs ("ncRNA") can be encoded by their own genes (RNA genes), but can also derive from mRNA introns.

ü The most prominent examples of non-coding RNAs are transfer RNA (tRNA) and ribosomal RNA (rRNA), both of which are involved in the process of translation. There are also non-coding RNAs involved in gene regulation, RNA processing and other roles.

ü Certain RNAs are able to catalyse chemical reactions such as cutting and ligating other RNA molecules, and the catalysis of peptide bond formation in the ribosome; these are known as ribozymes.

ü Messenger RNA (mRNA) carries information about a protein sequence to the ribosomes, the protein synthesis factories in the cell. It is coded so that every three nucleotides (a codon) correspond to one amino acid. In eukaryotic cells, once precursor mRNA (pre-mRNA) has been transcribed from DNA, it is processed to mature mRNA.

ü After a certain amount of time the message degrades into its component nucleotides with the assistance of ribonucleases.

ü Transfer RNA (tRNA) is a small RNA chain of about 80 nucleotides that transfers a specific amino acid to a growing polypeptide chain at the ribosomal site of protein synthesis during translation.

ü Ribosomal RNA (rRNA) is the catalytic component of the ribosomes. Eukaryotic ribosomes contain four different rRNA molecules: 18S, 5.8S, 28S and 5S rRNA.

ü Transfer-messenger RNA (tmRNA) is found in many bacteria and plastids. It tags proteins encoded by mRNAs that lack stop codons for degradation and prevents the ribosome from stalling.

ü Introns are spliced out of pre-mRNA by spliceosomes, which contain several small nuclear RNAs (snRNA), or the introns can be ribozymes that are spliced by themselves

ü Like DNA, RNA can carry genetic information. RNA viruses have genomes composed of RNA, and a variety of proteins encoded by that genome.

ü The viral genome is replicated by some of those proteins, while other proteins protect the genome as the virus particle moves to a new host cell. Viroids are another group of pathogens, but they consist only of RNA, do not encode any protein and are replicated by a host plant cell's polymerase.

ü In reverse transcription Reverse transcribing viruses replicate their genomes by reverse transcribing DNA copies from their RNA; these DNA copies are then transcribed to new RNA. Retrotransposons also spread by copying DNA and RNA from one another, and telomerase contains an RNA that is used as template for building the ends of eukaryotic chromosomes.

ü Double-stranded RNA (dsRNA) is RNA with two complementary strands, similar to the DNA found in all cells. dsRNA forms the genetic material of some viruses (double-stranded RNA viruses). Double-stranded RNA such as viral RNA or siRNA can trigger RNA interference in eukaryotes, as well as interferon response in vertebrates.

Assay: Proteins are assembled from amino acids using information encoded in genes.

III- Protein

Proteins are biochemical compounds consisting of one or more polypeptides typically folded into a globular or fibrous form in a biologically functional way. A polypeptide is a single linear polymer chain of amino acids bonded together by peptide bonds between the carboxyl and amino groups of adjacent amino acid residues. The sequence of amino acids in a protein is defined by the sequence of a gene, which is encoded in the genetic code. In general, the genetic code specifies 20 standard amino acids; however, in certain organisms the genetic code can include selenocysteine—and in certain archaeapyrrolysine. Shortly after or even during synthesis, the residues in a protein are often chemically modified by post-translational modification, which alters the physical and chemical properties, folding, stability, activity, and ultimately, the function of the proteins.

Sometimes proteins have non-peptide groups attached, which can be called prosthetic groups or cofactors.

One of the most distinguishing features of polypeptides is their ability to fold into a globular state, or "structure". The extent to which proteins fold into a defined structure varies widely. Some proteins fold into a highly rigid structure with small fluctuations and are therefore considered to be single structure. Other proteins undergo large rearrangements from one conformation to another. This conformational change is often associated with a signaling event. Thus, the structure of a protein serves as a medium through which to regulate either the function of a protein or activity of an enzyme. Not all proteins requiring a folding process in order to function, as some function in an unfolded state.

Like other biological macromolecules such as polysaccharides and nucleic acids, proteins are essential parts of organisms and participate in virtually every process within cells. Many proteins are enzymes that catalyze biochemical reactions and are vital to metabolism. Proteins also have structural or mechanical functions, such as actin and myosin in muscle and the proteins in the cytoskeleton, which form a system of scaffolding that maintains cell shape.        Other proteins are important in cell signaling, immune responses, cell adhesion, and the cell cycle. Proteins are also necessary in animals' diets, since animals cannot synthesize all the amino acids they need and must obtain essential amino acids from food. Through the process of digestion, animals break down ingested protein into free amino acids that are then used in metabolism.

Proteins may be purified from other cellular components using a variety of techniques such as ultracentrifugation, precipitation, electrophoresis, and chromatography; the advent of genetic engineering has made possible a number of methods to facilitate purification. Methods commonly used to study protein structure and function include immunohistochemistry, site-directed mutagenesis, nuclear magnetic resonance and mass spectrometry. Distributed computing is a relatively new tool researchers are using to examine the infamously complex interactions that govern protein folding; the statistical analysis techniques employed to calculate a protein's probable tertiary structure from its amino acid sequence (primary structure) are well-suited for the distributed computing environment, which has made this otherwise prohibitively expensive and time consuming problem significantly more manageable.

Biochemistry

Most proteins consist of linear polymers built from series of up to 20 different L-α-amino acids. All proteinogenic amino acids possess common structural features, including an α-carbon to which an amino group, a carboxyl group, and a variable side chain are bonded. Only proline differs from this basic structure as it contains an unusual ring to the N-end amine group, which forces the CO–NH amide moiety into a fixed conformation. The side chains of the standard amino acids, detailed in the list of standard amino acids, have a great variety of chemical structures and properties; it is the combined effect of all of the amino acid side chains in a protein that ultimately determines its three-dimensional structure and its chemical reactivity.

http://upload.wikimedia.org/wikipedia/commons/thumb/4/4d/Protein_repeating_unit.png/150px-Protein_repeating_unit.pnghttp://upload.wikimedia.org/wikipedia/commons/thumb/e/e5/Peptide_bond.png/185px-Peptide_bond.png

Chemical structure of the peptide bond (left) and a peptide  bondbetween leucine and threonine (right)

The amino acids in a polypeptide chain are linked by peptide bonds. Once linked in the protein chain, an individual amino acid is called a residue, and the linked series of carbon, nitrogen, and oxygen atoms are known as the main chain or protein backbone. The peptide bond has two resonance forms that contribute some double-bond character and inhibit rotation around its axis, so that the alpha carbons are roughly coplanar. The other two dihedral angles in the peptide bond determine the local shape assumed by the protein backbone. The end of the protein with a free carboxyl group is known as the C-terminus or carboxy terminus, whereas the end with a free amino group is known as the N-terminus or amino terminus.

The words protein, polypeptide, and peptide are a little ambiguous and can overlap in meaning. Protein is generally used to refer to the complete biological molecule in a stable conformation, whereas peptide is generally reserved for short amino acid oligomers often lacking a stable three-dimensional structure. However, the boundary between the two is not well defined and usually lies near 20–30 residues. Polypeptide can refer to any single linear chain of amino acids, usually regardless of length, but often implies an absence of a defined conformation.

Synthesis

Each protein has its own unique amino acid sequence that is specified by the nucleotide sequence of the gene encoding this protein. The genetic code is a set of three-nucleotide sets called codons and each three-nucleotide combination designates an amino acid, for example AUG (adenine-uracil-guanine) is the code for methionine. Because DNA contains four nucleotides, the total number of possible codons is 64; hence, there is some redundancy in the genetic code, with some amino acids specified by more than one codon. Genes encoded in DNA are first transcribed into pre-messenger RNA (mRNA) by proteins such as RNA polymerase. Most organisms then process the pre-mRNA (also known as a primary transcript) using various forms of post-transcriptional modification to form the mature mRNA, which is then used as a template for protein synthesis by the ribosome. In prokaryotes the mRNA may either be used as soon as it is produced, or be bound by a ribosome after having moved away from the nucleoid. In contrast, eukaryotes make mRNA in the cell nucleus and then translocate it across the nuclear membrane into the cytoplasm, where protein synthesis then takes place. The rate of protein synthesis is higher in prokaryotes than eukaryotes and can reach up to 20 amino acids per second.

The DNA sequence of a gene encodes the amino acid sequence of a protein.

The process of synthesizing a protein from an mRNA template is known as translation. The mRNA is loaded onto the ribosome and is read three nucleotides at a time by matching each codon to its base pairing anticodon located on a transfer RNA molecule, which carries the amino acid corresponding to the codon it recognizes. The enzyme aminoacyl tRNA synthetase "charges" the tRNA molecules with the correct amino acids. The growing polypeptide is often termed the nascent chain. Proteins are always biosynthesized from N-terminus to C-terminus.

The size of a synthesized protein can be measured by the number of amino acids it contains and by its total molecular mass, which is normally reported in units of daltons (synonymous with atomic mass units), or the derivative unit kilodalton (kDa). Yeast proteins are on average 466 amino acids long and 53 kDa in mass. The largest known proteins are the titins, a component of the muscle sarcomere, with a molecular mass of almost 3,000 kDa and a total length of almost 27,000 amino acids.

Structure

http://upload.wikimedia.org/wikipedia/commons/thumb/6/6e/Proteinviews-1tim.png/500px-Proteinviews-1tim.png

Three possible representations of the three-dimensional structure of the protein triose phosphate isomerase.


Left: all-atom representation colored by atom type. Middle: Simplified representation illustrating the backbone conformation, colored by secondary structure. Right: Solvent-accessible surface representation colored by residue type (acidic residues red, basic residues blue, polar residues green, nonpolar residues white)

protein

Most proteins fold into unique 3-dimensional structures. The shape into which a protein naturally folds is known as its native conformation. Although many proteins can fold unassisted, simply through the chemical properties of their amino acids, others require the aid of molecular chaperones to fold into their native states. Biochemists often refer to four distinct aspects of a protein's structure:


§ Primary structure: the amino acid sequence.

§ Secondary structure: regularly repeating local structures stabilized by hydrogen bonds. The most common examples are the alpha helix, beta sheet and turns. Because secondary structures are local, many regions of different secondary structure can be present in the same protein molecule.

§ Tertiary structure: the overall shape of a single protein molecule; the spatial relationship of the secondary structures to one another. Tertiary structure is generally stabilized by nonlocal interactions, most commonly the formation of a hydrophobic core, but also through salt bridges, hydrogen bonds, disulfide bonds, and even post-translational modifications. The term "tertiary structure" is often used as synonymous with the term fold. The tertiary structure is what controls the basic function of the protein.

§ Quaternary structure: the structure formed by several protein molecules (polypeptide chains), usually called protein subunits in this context, which function as a single protein complex.

Proteins are not entirely rigid molecules. In addition to these levels of structure, proteins may shift between several related structures while they perform their functions. In the context of these functional rearrangements, these tertiary or quaternary structures are usually referred to as "conformations", and transitions between them are called conformational changes. Such changes are often induced by the binding of a substrate molecule to an enzyme's active site, or the physical region of the protein that participates in chemical catalysis. In solution proteins also undergo variation in structure through thermal vibration and the collision with other molecules.

Proteins can be informally divided into three main classes, which correlate with typical tertiary structures: globular proteins, fibrous proteins, and membrane proteins. Almost all globular proteins are soluble and many are enzymes. Fibrous proteins are often structural, such as collagen, the major component of connective tissue, or keratin, the protein component of hair and nails. Membrane proteins often serve as receptors or provide channels for polar or charged molecules to pass through the cell membrane.

A special case of intramolecular hydrogen bonds within proteins, poorly shielded from water attack and hence promoting their own dehydration, are called dehydrons.

Enzymes

The best-known role of proteins in the cell is as enzymes, which catalyze chemical reactions. Enzymes are usually highly specific and accelerate only one or a few chemical reactions. Enzymes carry out most of the reactions involved in metabolism, as well as manipulating DNA in processes such as DNA replication, DNA repair, and transcription. Some enzymes act on other proteins to add or remove chemical groups in a process known as post-translational modification. About 4,000 reactions are known to be catalyzed by enzymes. The rate acceleration conferred by enzymatic catalysis is often enormous—as much as 1017-fold increase in rate over the uncatalyzed reaction in the case of orotate decarboxylase (78 million years without the enzyme, 18 milliseconds with the enzyme).

The molecules bound and acted upon by enzymes are called substrates. Although enzymes can consist of hundreds of amino acids, it is usually only a small fraction of the residues that come in contact with the substrate, and an even smaller fraction—three to four residues on average—that are directly involved in catalysis. The region of the enzyme that binds the substrate and contains the catalytic residues is known as the active site.

Cell signaling and ligand binding

http://upload.wikimedia.org/wikipedia/commons/thumb/3/3b/Mouse-cholera-antibody-1f4x.png/220px-Mouse-cholera-antibody-1f4x.png

Many proteins are involved in the process of cell signaling and signal transduction. Some proteins, such as insulin, are extracellular proteins that transmit a signal from the cell in which they were synthesized to other cells in distant tissues. Others are membrane proteins that act as receptors whose main function is to bind a signaling molecule and induce a biochemical response in the cell. Many receptors have a binding site exposed on the cell surface and an effector domain within the cell, which may have enzymatic activity or may undergo a conformational change detected by other proteins within the cell.

Ribbon diagram of a mouse antibody against cholera that binds a carbohydrate antigen

Antibodies are protein components of adaptive immune system whose main function is to bind antigens, or foreign substances in the body, and target them for destruction. Antibodies can be secreted into the extracellular environment or anchored in the membranes of specialized B cells known as plasma cells. Whereas enzymes are limited in their binding affinity for their substrates by the necessity of conducting their reaction, antibodies have no such constraints. An antibody's binding affinity to its target is extraordinarily high.

Many ligand transport proteins bind particular small biomolecules and transport them to other locations in the body of a multicellular organism. These proteins must have a high binding affinity when their ligand is present in high concentrations, but must also release the ligand when it is present at low concentrations in the target tissues. The canonical example of a ligand-binding protein is haemoglobin, which transports oxygen from the lungs to other organs and tissues in all vertebrates and has close homologs in every biological kingdom. Lectins are sugar-binding proteins which are highly specific for their sugar moieties. Lectins typically play a role in biological recognition phenomena involving cells and proteins. Receptors and hormones are highly specific binding proteins.

Transmembrane proteins can also serve as ligand transport proteins that alter the permeability of the cell membrane to small molecules and ions. The membrane alone has a hydrophobic core through which polar or charged molecules cannot diffuse. Membrane proteins contain internal channels that allow such molecules to enter and exit the cell. Many ion channel proteins are specialized to select for only a particular ion; for example, potassium and sodium channels often discriminate for only one of the two ions.

Structural proteins

Structural proteins confer stiffness and rigidity to otherwise-fluid biological components. Most structural proteins are fibrous proteins; for example, actin and tubulin are globular and soluble as monomers, but polymerize to form long, stiff fibers that comprise the cytoskeleton, which allows the cell to maintain its shape and size. Collagen and elastin are critical components of connective tissue such as cartilage, and keratin is found in hard or filamentous structures such as hair, nails, feathers, hooves, and some animal shells.

Other proteins that serve structural functions are motor proteins such as myosin, kinesin, and dynein, which are capable of generating mechanical forces. These proteins are crucial for cellular motility of single celled organisms and the sperm of many multicellular organisms which reproduce sexually. They also generate the forces exerted by contracting muscles.

Methods of study

As some of the most commonly studied biological molecules, the activities and structures of proteins are examined both in vitro and in vivo. In vitro studies of purified proteins in controlled environments are useful for learning how a protein carries out its function: for example, enzyme kinetics studies explore the chemical mechanism of an enzyme's catalytic activity and its relative affinity for various possible substrate molecules. By contrast, in vivo experiments on proteins' activities within cells or even within whole organisms can provide complementary information about where a protein functions and how it is regulated.

Protein purification

In order to perform in vitro analysis, a protein must be purified away from other cellular components. This process usually begins with cell lysis, in which a cell's membrane is disrupted and its internal contents released into a solution known as a crude lysate. The resulting mixture can be purified using ultracentrifugation, which fractionates the various cellular components into fractions containing soluble proteins; membrane lipids and proteins; cellular organelles, and nucleic acids. Precipitation by a method known as salting out can concentrate the proteins from this lysate. Various types of chromatography are then used to isolate the protein or proteins of interest based on properties such as molecular weight, net charge and binding affinity. The level of purification can be monitored using various types of gel electrophoresis if the desired protein's molecular weight and isoelectric point are known, by spectroscopy if the protein has distinguishable spectroscopic features, or by enzyme assays if the protein has enzymatic activity. Additionally, proteins can be isolated according their charge using electrofocusing.

For natural proteins, a series of purification steps may be necessary to obtain protein sufficiently pure for laboratory applications. To simplify this process, genetic engineering is often used to add chemical features to proteins that make them easier to purify without affecting their structure or activity. Here, a "tag" consisting of a specific amino acid sequence, often a series of histidine residues (a "His-tag"), is attached to one terminus of the protein. As a result, when the lysate is passed over a chromatography column containing nickel, the histidine residues ligate the nickel and attach to the column while the untagged components of the lysate pass unimpeded. A number of different tags have been developed to help researchers purify specific proteins from complex mixtures.

Cellular localization

http://upload.wikimedia.org/wikipedia/commons/thumb/6/6e/Localisations02eng.jpg/300px-Localisations02eng.jpg

The study of proteins in vivo is often concerned with the synthesis and localization of the protein within the cell. Although many intracellular proteins are synthesized in the cytoplasm and membrane-bound or secreted proteins in the endoplasmic reticulum, the specifics of how proteins are targeted to specific organelles or cellular structures is often unclear. A useful technique for assessing cellular localization uses genetic engineering to express in a cell a fusion protein or chimera consisting of the natural protein of interest linked to a "reporter" such as green fluorescent protein (GFP). The fused protein's position within the cell can be cleanly and efficiently visualized using microscopy, as shown in the figure opposite.


Proteins in different cellular compartments and structures tagged with green fluorescent protein (here, white)

Other methods for elucidating the cellular location of proteins requires the use of known compartmental markers for regions such as the ER, the Golgi, lysosomes/vacuoles, mitochondria, chloroplasts, plasma membrane, etc. With the use of fluorescently tagged versions of these markers or of antibodies to known markers, it becomes much simpler to identify the localization of a protein of interest. For example, indirect immunofluorescence will allow for fluorescence colocalization and demonstration of location. Fluorescent dyes are used to label cellular compartments for a similar purpose.

Other possibilities exist, as well. For example, immunohistochemistry usually utilizes an antibody to one or more proteins of interest that are conjugated to enzymes yielding either luminescent or chromogenic signals that can be compared between samples, allowing for localization information. Another applicable technique is cofractionation in sucrose (or other material) gradients using isopycnic centrifugation. While this technique does not prove colocalization of a compartment of known density and the protein of interest, it does increase the likelihood, and is more amenable to large-scale studies.

Finally, the gold-standard method of cellular localization is immunoelectron microscopy. This technique also uses an antibody to the protein of interest, along with classical electron microscopy techniques. The sample is prepared for normal electron microscopic examination, and then treated with an antibody to the protein of interest that is conjugated to an extremely electro-dense material, usually gold. This allows for the localization of both ultrastructural details as well as the protein of interest.

Through another genetic engineering application known as site-directed mutagenesis, researchers can alter the protein sequence and hence its structure, cellular localization, and susceptibility to regulation. This technique even allows the incorporation of unnatural amino acids into proteins, using modified tRNAs, and may allow the rational design of new proteins with novel properties.

Proteomics and bioinformatics

The total complement of proteins present at a time in a cell or cell type is known as its proteome, and the study of such large-scale data sets defines the field of <%2

المواد الدراسيه Courses

الجدول الدراسي

أضغط هنا

الساعات المكتبية

الأحـد 10-2 * الأثنين 12-3 * الثلاثاء 11-2

أعلانات : أختبــــارااااااات

First Mid-Term Examination Schedule - Second Semester 1435-1436

Day

Date

Course Name

Code & Number

Wednesday

13 / 5 / 1436

Medical Genetics

MDL 322

Thursday

14 / 5 / 1436

Histology

MDL 211

MDL 242

Monday

18 / 5 / 1436

Hematology

MDL 311

MDL 241

Tuesday

19 / 5 / 1436

Electron Microscope

MDL 314

MDL 362


ترقبو ا حدول أختبارات أعمال السنة الثاني ... قريبا

Second Mid-Term Examination Schedule Second Semester 1435-1436

مقالاتي: انت دمك خفيف

1- انت دمك خفيف!!!

كن متميزا

كيف تتفوق ...  هل فكرت يوما أن تعرف أسرار التفوق من أصحاب التفوق أي من الأوائل أنفسهم من أسرار التفوق مايلي :-

شاهد العلم

التقويم : اليوم والساعة

إحصائية الموقع

عدد الصفحات: 45

البحوث والمحاضرات: 96

الزيارات: 135951